Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10m02
Contig Information
Length 477 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10m02   
Homology (BLAST) Top Hit thioredoxin peroxidase [Secale cereale]
Score 463
Evalue 6.13112e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10m02
CAAATCAATCTCAAAGTCTTTTGGTGTATTGATCCCTGATCAGGGAATTGCTCTGAGAGGATTATTCATCATTGACAAGGAGGGTGTGATTCAGCATTCC
ACTATTAACAACCTTGGTATTGGCCGCAGTGTGGATGAGACCTTGAGAACCCTTCAGGCTCTGCAATACGTCCAAGAAAACCCAGACGAGGTCTGCCCGG
CAGGATGGAAACCTGGGGAAAAGTCGATGAAGCCTGACCCTAAGGGCAGCAAGGAGTACTTCGCTGCCATCTAGACGCGTCCTTTGCACTCGCTGTCGAG
TTTTGTCATGGCCGTTTCTCGGTTACATGTGTTTTTGTGACCCGAGTTGTAGTTATCACGCGTACAATTGACTCTGTAATTTCTACAATAAGGGTTTGTC
TGTGTGTGGATCTTCCCTGCTCCAATTTGGAAAGAACAATACAAGATTGGAAATAAAATCTTATCTTAAAAAAAAAA
page-top