Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11d04
Contig Information
Length 707 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11d04   
Homology (BLAST) Top Hit RecName: Full=Aldose reductase; Short=AR; AltName: Full=Aldehyde reductase >gi|18891|emb|CAA40747.1| aldose reductase-related protein [Hordeum vulgare subsp. vulgare]
Score 910
Evalue 2.34603e-96
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11d04
ATTGTGTTGTACACAACGTTGTTTACATAGCATCAAGAAGAGCCTGCTGCATCATCTCCACTCCACTCCTTCAGCCTCCATTGTTGTGAGTCGTCGTAGA
TGGCGACTGGTGACTTAGGTGGGAGCTCAGTTCTCGTGATCCCAGACTTCAGATGCACTCTTGTACGGCCCATGGGTCTTGTTCACGAACAGCTCCTCTC
CGGTCAGCACACGCTTCTCATCTTTGATGCTGCACAGGACCTTGAAGTCCTCCTCAGGGATCTCCCACCCGAACACCTGGATGTTCTCCTTGATCCTCTC
GTCTTTGCTTGACTTGGGAATCACACTCGTCCCCCTCTGCAGAGCCCACCTGATGAGCACCTGCCCCGGGGTCTTGTTCAGCTTGTTGGCCACCTTTTCG
ACAACCGGGTCATGAGCAAGGTTCTTCTCTGAAGAACCCAATGGTGAGTAAGCGGTGACATGGATCCCGCGCTTCTTGCAGGCCTCGAACATCTTGTCGT
TCTTCCAACCAGGGTGCATCTCCATCTGGCAAACGGCCGGTGGAATCTTTGCAGACCGTAGCAGCCGGTCGAGCTTGGTCACGGTGTAGTTGCAGACGCC
GATGTCCTTAACCAGTCCGTCCTTGACAAGGTTCTCCATCTCCTTCCACACCCCCCTCCATGTCGAATTCCANGCACCTCCCCTGCTTCCGGAGGNTTGT
GTGCCCC
page-top