Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd10n04
Contig Information
Length 708 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd10n04   
Homology (BLAST) Top Hit hypothetical protein OsI_12908 [Oryza sativa Indica Group]
Score 545
Evalue 4.94883e-54
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd10n04
CAATTTATACAAACCAGGCACACAAACTTTCTCTGAAACAACAGCATTTCCAGTGCTGATGATACGTGCATCACAGCCACTCATCAGGTCAGCAGCGCAA
ACATGTCAATCTGCTCACATTGCTGCCACAGTTTTACACAACAACAGCAACTCGGACAGAATAAATATACATACAATGGAGGCGGCGAAATGCGGTTACA
ATATCAAAACCTTACGTCTCAATGGGCGAAATGCGAAATACCCATGAGCTTCTTCTAGTTCTTAATCTCGACGTCGTTCAGCCCCCCTCTCGGGCTACTG
GCATTGCTCGGCGGCTCATACTCCTGGCTCGGGAAGACCTCCGACTGCAGGCCCGTCGAGATGTTGTTCACATGGAGCCACGTCAGCTCCCACAGGCTGT
CGCCCCCTATCGTGCTCCTCTTGGCGAGGATCCCCCTGCTCTTCATCGCGACCAGGATGTTCCTGAGAAGGTCCAGGATCAGTTCCTGAAGCTTGTCGCT
GCGCTTGCCCCGGACCTTGGTCTTGATGCACTTCTCCATCCGGCTGAGGACCCCCAGCCACAGCTTGCAGAAGCTGCTCAGCCCGAAGAGGTCTGGTAAC
AGCTGAAGGTAGACCTTCGCTACCAGTTTCACGGCGAGCACGAGGGATCCTTCCATGTTCCTGTGGTCCTTCTGTGAGTGGTTCTGGGCGATTTCCANCA
AGTCGTCC
page-top