Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd10o02
Contig Information
Length 659 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd10o02   
Homology (BLAST) Top Hit GH17073 [Drosophila grimshawi] >gi|193898939|gb|EDV97805.1| GH17073 [Drosophila grimshawi]
Score 87
Evalue 0.54579
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd10o02
AGCTTCAAACACACTTTACATCAGGACCGAAAGAAAAAGAAAGATTACAACGAAGTCCCAGACTTTTGCATGGAGAACCCCTAACTGAAAGATTAAAATG
CAATCGGGTCCTTGGCAGCCTTCGCTCAGATTGAACCTCGCCGTCGCCGGGGACGAACTACTTGGGGCGACGAGATCGCCATGGGTGCAGCACGTGCATC
CCAGAGCCTCTGAACGAAAACTGGAACTGCCTCCCATAAGGCATGCAAGCCAGGAGGAAAGGGGTTGGCCGCCCTTCGACCAGAAGAAGCAGAGGGTCGA
TGAAGACCGGCAGCCGACTGCAGGCGCCGTAGCTCCACCATAGAATCCTCTGCTGATGAGCTCGAACCCGACCATCAATCTTCAGCTCAGTGCTTCCCCA
CCCCTCTTCATCCACCACCTTGGCGGCATCAAGTGGAGGAAGGTAGCAACGAGGCCTCCTGCAAGTGGCAGGCATGTACATCTCCTGCTGCTCTATCTCT
CTTCCCACAACCATGATGGTAAGAACAGATCGAGGAAGAAGAGCATCTGGCGCACCATATTGGGATTTATTACAGCAAAAAAAGGGGGGAGAAGTGGGGA
CNAAACCGGACGGGCCTAAGCTTCGCCATGGATCCGGCTGAGGGAAGCCGCCGAAGGAT
page-top