Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd10n17
Contig Information
Length 744 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd10n17   
Homology (BLAST) Top Hit hypothetical protein OsJ_034570 [Oryza sativa (japonica cultivar-group)]
Score 390
Evalue 5.19044e-36
Total Hit Count 167
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd10n17
ATAAGTCAACACCACTTACTGGAGACGACAGACGCCAAAAGGGCATGGATAAAAACTCGCAGTGAAATCGAAACTACTACTACTGCTAGGAGGAACCGAA
ATCTAGCCTTCAGTTGACACGCTGCCTCTTCTGGGGAACACCCTTGGACTGCTGGGGATTCAACTGCCGTTTTGCTTTCTCCCTCCGCCGCTGCCTCTCG
TCTTCGCTGTCGGATTCGCTGCCCATCTCCATGTCGGCATCCCTCGCCTTGCGCTCCATCTCGTCCCATGACTCGGCAGCGTCGTCGTCGTCGTCGTCGT
CATCTGAGCCAGCCGAGATAGCCTCATCCTCGCCAGAATCCACCACTGATTCGCTGTCGCTGTCTTCATCATCCGAATCAGAGGCTGACTCCGCTTCAGA
AGGTTCGTACTTGTCATCGTCTGTCTCAGAATCCTCTGAATCTGAGTCAGTAGCATCTGGATTCAAGAATTCCCACCTGTCATTTGTGTCACAACCTGGC
TCGTCGAGCTTCTTGAGGACCATTCGCCAGTTGAGGTTCAGCTTTGATTCATAGTACTTCAAGTTGCTGTCATTAAGCCAATCTTTGATCTTGTCAAGAG
ATGCCATTGGAATGACCTCTATGCGGACAACATCTCGCTTTAAATCTTGAAATACAAACACCATGTCNAAGGATTTCTGCCCCANGGCCACCCTTTCCAA
GCATACTATCTCNACCTCCCTCAANGAANNCACAANAAACGGNG
page-top