Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10l11
Contig Information
Length 834 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10l11   
Homology (BLAST) Top Hit hypothetical protein OsI_21558 [Oryza sativa Indica Group]
Score 595
Evalue 1.0812e-59
Total Hit Count 230
Registered year 2003
Contig Sequence     [ Download ]
>whvd10l11
CCGTCCCCCTTCACTAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAGACGCCGGAGGCTGGAGGGGATTTGAAGAGACCGCCGTGCGGCGGGTCTGGATTT
AGATTGAAATTCCACTGGAGGGAAGGAAGGAGAGAGAGAGAGATCTATTTAGGTTACCACAAGTCAATGGAGCGGCAGCCGGCAGTCCGGCGACGGCGAG
CTCAAGACACTAATGGATTGGTTGCTTCACAGGCCAAAATAAATGTCTTGCCCTGTCAGCAAGATGATGATTCTCAGGGTGATTCACAGATGCCAAACCT
TCCAGAGGACATTTGGCGTCACATACATTCCCTGATGCCAATGCGAGATGCTGCCCAAGCTGCCTGTGTCTGTCATGCTTTTCTACGTTCCTGGAGGTGC
CATCCCAACCTCACTTTTTCTGGCACAGCATTGGGTATGAATAAAAAGACTTGTGTAAATGATGAAATTGCCAGAGACTTTCGTAGCAAGGTTGACCAGA
TCCTGAAAAAACACTCAGGCATTGGTGTGAAGAAACTTAAACTTACGATTGACATGATTCAATATTACACTGCCAAGGATTATTGTTATGTCAACAGTTG
GCTTCTGATTGCTGTCACACCAGGAATTGAGGAACTTACACTCCAACTGTCTATGGGGGAATACAATTTTCCATGCTCACTTTTGTCTAATGGGAGTGGA
GAGTCAATCCGTTATCTCCATCTTTGTGGTTGCTCCTTTCGACCCACAGCTGAACTTCCTTGGTTAAAAAGCTTGACAAAAGTGCGGCTTCATGCTGTCC
GTTTTACTGGGGATGAGTTAGGGTGCCTTCTGTG
page-top