Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11c17
Contig Information
Length 306 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11c17   
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162662242|gb|EDQ49150.1| predicted protein [Physcomitrella patens subsp. patens]
Score 75
Evalue 5.99385
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11c17
AAAGCANNACATGTTGCTACATACGGATGATAGAATAGATGCCTGCTAATATTTACGAGAGCTGATCAGANTTGGATGGCATCAGGGNGGGGACTGCTCC
TCNGATGCTCGTTCTTCCCGCCGCATGGTTCACCGCTTGGTGCATCGTCCGTCTGTCTGTCGGATGTCCCTGGCGCTAATAANCGGNATGATGCGCTCAA
CCCCTGGCCAAAAGCTTAGCGCTTGGGTTGGGGCGGGCTCGTGGGTCGGGGAGGGCTGGTGCGGGAGCCACGTCNCCTCGGNTTTGGTGGACTGGTAAGG
GAGGAA
page-top