Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20c06
Contig Information
Length 801 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20c06   
Homology (BLAST) Top Hit calcium-dependent protein kinase [Triticum aestivum]
Score 1106
Evalue 9.37149e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20c06
GTTTGCTTATGGTTTGCATTATATATTAAAACATCTCTCTACAACTCTGTTCATCAAGAGGCCCAAGTTTCCTCAGGTCTATTTTCCCTTCCTCATCATT
TCCACAAACTCTTCGTAGTCGATATTCCCATCTCTGTCTTTGTCAACTTCGTCCAATACTGCTTTAATATTTGCTTCATCACCCATTCCATACTCTGTCA
TGGCTTGTTCCAGTTCTTCTCTTGATATGTACCCGCTGTTATCTTTGTCAAAGTGTTGAAATGCATGGAGCAGATCCTCCTCCTTTTCCAGCTTATGTTT
ATTCATCATAGCAGTCAGGAATTCTGTGTAATCTATGCTGCCACTCTTGTCTACATCAACTGCTTCCATAAGCTTCTGAACCTCTGCCTCAGTGATCTTT
GACCCTAACTTTGTTAAACCAATCTTGAGTTCTTCAACTGTGATAGTCCCACTCTTGTCTGTGTCCATGTTATTGAACATCTGTTTCAGGCCCTTGATTT
CCTCAGGTGACAGGTTCTCTGCAATTACCTTAAGCGCCAGTTGTTTTAGCTTGTTCATCGCCTTGAATTGCTTCATTCTTGATAGGACTGCGCTGTCGAT
AGGCCTGTCGGATGCACCGCCTTCTTTGAGCCATGGATGTTCTAGGGCCTGTGCTGCCGTGATACGCCTTTTGGGATCTCTGTTTAACATTTGTCTGATA
AGATCCTTTGCACTCTCANATATCGGCGGCCAGGGGCTGCTACTGAAATCNAAGCTGACCCACCAGTATTGCGTCAAAAAATGCCCCTTCNCAGNTTCTG
C
page-top