Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20d10
Contig Information
Length 142 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20d10   
Homology (BLAST) Top Hit hypothetical protein OsI_35541 [Oryza sativa Indica Group]
Score 155
Evalue 3.13459e-09
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20d10
CNGCCGGGCTCCATCTNTTATTGTGTCANNGAGATCCANTTTCTTCTCCAGNTTTTGACTCNACACAGNTTGCAGGCTATTGCTCTTCAGNGCNGGATTG
GTACTCATCTTTGACACATTTTCCTTGGCAAGAACTATAAGG
page-top