Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20d13
Contig Information
Length 727 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20d13   
Homology (BLAST) Top Hit hypothetical protein [Triticum aestivum]
Score 727
Evalue 3.22422e-83
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20d13
CTATGATAATAAAGCACAAGCAGACAACAGATTACATACACTGTGGCATCAAAGATCGGCACCAGATGCAATTAAACACGCCGAAAAAATAATATACAAA
CCGACAGCACTTCAATAGAGTTCAAGAAAGGTTAGCCCTACTCGAGAGCTGCAGTGCAAGCAGCTGAGCAAGCTGGTGAGACTGCAATTGTTTGACACTT
ATATCCTCCTCACTATTATTGGTGAAGGCAGGCTCTATAAAGCCCTTGTCCATGCTGATGGGGGGCAATTCAAGAAGTTTACCACAGAATTTTCTTCATA
AGCATTGCCTTTATTAAGAGCAAAGCAGCGGGCAGCATATTTGCGATATCCTGTCGTTCTTTTCAAACCGGAATTCTTTTTCGAGCAGATTTCCTCATCC
TCGGAACGAGACCNGTGCATAACAAGGTTTTTCCATTCAATGTCTTCTAAATTTAGCACAGGAGACTTCACCAGAAATTCGTTTAGAGACTTGCCATCAA
AGTGTGATTTCCTCAGGTAACACCAATACTGCTGCAATGCTTCCTTGAAAAGCATAAGCAAGCTTTGCTCGTCATGACTATCCAGATTGACCCTCGCACG
TAAGTGGGACAGGAAGATGTGAAAATGGTGTTTGTCTTCACTATAATCTTCCCATGATGGGAATATATGCACGTAGTCCCTAACAACATTGAAAGCATTG
TCTTTTAAACTGGGAATAACTANAATG
page-top