Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11c16
Contig Information
Length 727 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11c16   
Homology (BLAST) Top Hit protein kinase ABC1063 [Hordeum vulgare subsp. vulgare]
Score 817
Evalue 3.83796e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11c16
ATTCTCTTGACAGATTCAAAGGCTAGTCTTCCCCTCAAGTCCGGCATCTGTTCACTGTTTCTACTCCCTGAAGTGTTGCTTACAAGGAGTGGATGATGCA
TGCTCCAGAGAGGTAAAGGAGTACACATGGAACCAGCAACCCTCCCCTACTTGTATGTTTTCTTCACCTCTGGGAGCTTTTCCAGCGCGGTCACGACCTG
ATCCATGTCCGGCCTGCACCGGGCGTCCATTGACAGGCATTGCATCGCAAGCGCCGCTGCCTTCTGCGCCGCCGGGAGCGAATATTGCGACCCCAATCGT
GGGTCCAGGACATGGATGACCCTCCTCTTGCTGTTGATGTAAGGTCTTGCCCACTCCACCAGGTTATGCTGTCCAGGCGGGCGGTTCTTGTCCAGAGCAC
GTTGCCCGGTCAGCAACTCTAGAAGAACAACACCATAGGTGTAGACATCGCTCTTCGTGGTCAAGTGGCCTGTTGCGAGATATTCAGGGGCAGCATATCC
TTGAGTCCCCATGACCCTAGTAGAAACATGACTTTTATCGCCACTCGGGCCATCTTTTGCCAAGCCAAAATCAGAGAGTTTTGCATTATATTCCGAGTCA
AGAAGAACATTANAGGTCTTGAAATCACGGTATATAACTTTANCCTCATCACTATGCANGAAAAGCAAGTCCCCTGGCGGCCTCAANAGCAACCTTCATC
CGTAAATTCCATGAAAGGGGCTGGNAA
page-top