Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20f20
Contig Information
Length 269 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20f20   
Homology (BLAST) Top Hit hypothetical protein OsI_25831 [Oryza sativa Indica Group]
Score 434
Evalue 1.41944e-41
Total Hit Count 152
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20f20
GCCCTCTTCAGACCATCCTGCAAGAAAAATGCCTTGCGCTGTAGTGAAAGCCTGATCCTCCATTCCATGGAGCAGCATCGTTGCAGCTAAACTGTATGTT
ACTCCAGTCCAGATTTCTCTTGACTGCATACATGTCTCGTCTACCTTCCCATTTGGGTGCATACCATTGACTGCTCCAATGCGTCCTCCTTTCACCCTCA
TCACATTATAGTCAAATATTTTTTGAAGCGTGCATTTTATTCTGTCCTCATCAAACANAAGGTGGCAAG
page-top