Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd8d23
Contig Information
Length 763 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd8d23   
Homology (BLAST) Top Hit hypothetical protein OsJ_017847 [Oryza sativa (japonica cultivar-group)]
Score 1314
Evalue 3.86872e-143
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd8d23
ACCGGAAGGTCCATGTGCTCTTTGTGACGGACTGCTTCCCCATCCCCAACCTCTTCCCCTGCAAGAACCTTGTGAAACATGAAGGCAATGCCTGGTTGTA
TAGGCCTGATTTGAAAGCAGTAAGGGAAAAGCTTAGGCTTCCTGTTGGATCATGCGAGCTTGCTATTCCACTTAAAGCAAAAGCAAGACTTTTCTCAGTC
GACCGAAGAAGAGAAGCATATGCCACGATACTGCATTCAGCAAGTGAATATGTATGTGGTGCCATCACAGCAGCTCAGAGCATCAGGCAAGCAGGATCAA
CAAGAGACTTGGTCATCCTAGTTGATAACACCATAAGCGATCACCACCGGAGAGGCTTGGAAGCCGCAGGCTGGAAGGTCAGGATAATTGAAAGGATCAG
GAACCCAAAAGCCGAGCGAGACGCCTACAACGAGTGGAACTACAGCAAGTTCAGGTTATGGCAGCTGACCGACTACGACAAGATCATATTCATAGATGCT
GACCTGCTCATCCTGAGGAACGTGGACTTCCTGTTCGCGATGCCAGAGATCACCGCGACGGGCAACAACGCGACTCTCTTCAACTCCGGCGTCATGGTGA
TCGAGCCCTCCAACTGCACGTTCCAGCTGCTGATGGAGCACATCAACGAGATCACGTCGTACAACGGGGGCGACCAGGGGTACCTGAACGAGATATTCAC
ATGGTGGCACCGCATCCCCAAGCACATGAACTTCCTGAAGCACTTCTGGGAGGGCGACAGCGA
page-top