Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20g03
Contig Information
Length 327 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20g03   
Homology (BLAST) Top Hit Os06g0115300 [Oryza sativa (japonica cultivar-group)] >gi|55295897|dbj|BAD67765.1| putative Acyl-CoA-binding protein [Oryza sativa Japonica Group] >gi|55296187|dbj|BAD67905.1| putative Acyl-CoA-binding protein [Oryza sativa Japonica Group] >gi|113594651|dbj|BAF18525.1| Os06g0115300 [Oryza sativa (japonica cultivar-group)] >gi|125553804|gb|EAY99409.1| hypothetical protein OsI_21380 [Oryza sativa Indica Group] >gi|125595830|gb|EAZ35610.1| hypothetical protein OsJ_019093 [Oryza sativa (japonica cultivar-group)] >gi|215765112|dbj|BAG86809.1| unnamed protein product [Oryza sativa Japonica Group]
Score 187
Evalue 6.23368e-13
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20g03
CAGGCGGGGCTTGTTCACGTAATTACACCCAATACGACGATAAGCTTAGACAGATAGCACTTCAAATTTATTTGTGTTTATTGGCACATATGTCTGCACC
ACCATGGATAAAAGTAGGTTCTGTGGCCTAGGAAGAAGCGGATGCGGCGGCAGCCTCCTCGAGCAGCTGCTTCACCTTGGTGATGTAGTCCGCCATCGCC
TCCTCCTTGGATTTCGCTTCGACGGACTTCCAGGCGTCCCACTTGGCCTTGCCCTTAAGGTCGAACATTCCGGGGCGGGCTGTCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTCTCTCT
page-top