Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10k03
Contig Information
Length 389 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10k03   
Homology (BLAST) Top Hit magnesium chelatase 40-kDa subunit [Hordeum vulgare subsp. vulgare]
Score 525
Evalue 3.94301e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10k03
TCACTCCGACCCCTTCGACCCCGAGGTCATGGGCCCCGAGGTCCGCGACCGCCTCCTCAAGGGCGAGGACCTTCCCGTCACCACCACCAANATCACCATG
GTCGACCTGCCCCTCGGCGCCACCGAGGACAGGGTGTGCGGCACCATCGACATTGAGAAGGCGCTCACCGAAGGTGTCAAGGCGTTCGAGCCAGGCCTGC
TCGCCAAGGCCAACAGGGGGATACTGTATGTGGACGAGGTCAATCTGCTGGACGACCATCTGGTGGATGTTCTGCTGGATTCCGCGGCTTCCGGGTGGAA
CACGGTGGAGAGGGAGGGCATCTCCATCTCCCACCCTGCGCGGTTCATCCTCATTGGGTCCGGTAACCCGGANGAAGGCNAGCTCCGGC
page-top