Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8f22
Contig Information
Length 715 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8f22   
Homology (BLAST) Top Hit hypothetical protein OsI_28098 [Oryza sativa Indica Group]
Score 725
Evalue 6.83376e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8f22
GAGCTCACTCTGTCTTTTCAATGTTTCGTCACAAATTTGTTAAAAAAAATGAAAGTCAAAACGGAATCAAGGGGTACAAGTAATCAATTTATAAAGAATA
AAATCATGACATTGCATATAGATAATACAATTTAAATGTAGTTCATCGGTCAGTCATGCCAATTTGCGAATAAGGTAGGGGAGGATGCCTCCATGGTTAA
AGTATTCCAGCTCCACCTGTGTGTTAATGCAAAGTGTGCAAGTGAAGGATTTCCCATTTTTTGTCGTAACGATCACATCTTGGCCTGGACGGATCTCGGT
AATCTTGCGAGGGAGGTCGATCGTGAAACGCTCATGCCCACTGAGGTTGAGTGAATCTGCATCCTCGCCAGCCTTGAAGCGGAGAGGGATGATCCCCATC
CCCACCAAGTTACTCCGGTGGATGCGCTCGAAGCCCTTAGCGATCACTGCCTTGACGCCCAGGAGCAATGGCCCCTTGGCGGCACTATCACGCGAGCTCC
CGGCTCCATACTCATCACCGGCAAGAATGACCATGTCATGACCCTCCGACTTGTATTTCATGGCAGCGTCGAAAACGTAATGCTTCTCCCCCGTAGGGAC
ATGGACAGTTTTAGGCCCCNCCTCTCCCTCCAAAAGCTTGTTCACAATCCTAATGTTGGCAAATGCCCTCTCACAACGATCTCGTCNNTGGCACGTCNGC
TGCCATATGTGGNGA
page-top