Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8g02
Contig Information
Length 405 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8g02   
Homology (BLAST) Top Hit hypothetical protein OsI_20353 [Oryza sativa Indica Group]
Score 394
Evalue 6.19027e-37
Total Hit Count 137
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8g02
AATTGCCATGCCATTGGTGATCTTGCGTCTCACTCATGTCAGGATTCAGGGCAGAATTTATGGGATGGACATCTATATGGATACTATATGCAGGGGTTTG
ATCGCTTGTTCTATGTAGCCAGACATATCAATTACTATTTGGTGAGCTGCAGCTTTGACAGGACGGCGGCGGCCCGATCTCCGCCAAGCAGGAAATAGGG
GTGCCGGAGCGCGGCGGCGGCGGAGAGCCGCCCCTTCTCCCGCTGCGCGATGAGCTTGGTGGCCAGGTCCCAGCCTCTGCCGGAGTCGAGGTCCAGGATC
TGCANGTCGGGTCTCCGGCGCGTGGTCTCCCGCCACCTGTTGAGGTCGTAACCGGCGGCCTTGAGCTCNGAGTTGAAGTTCTTGACGCCCNACGGCGACC
TGATC
page-top