Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8h08
Contig Information
Length 335 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8h08   
Homology (BLAST) Top Hit chloroplast sigma factor [Triticum aestivum]
Score 536
Evalue 2.0941e-53
Total Hit Count 217
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8h08
TGGCATTGTTTCCCTATACCATGGTATAACTGAATAATGTCCCTCTCACGTTCAGTGAGATTTGAGTTTAGAAGTTTGTTGACTTCCTCCTTTAGGTACC
ACTCCTCAAATCCATGCCATGGGTCATTCGCAACATTTTGATCCTCTATATAGCTGTGGAGTGTATCTCCGGGTAGGCCATTTAAGGAGGGGAATGCCTG
TTGATCCAACGAAAGAGCCTTATTGACAGCCTCTGCAGCATTGTGCACTTTCTTCTCCGATATATTGAGCAACTTTGCGATGTTTTGCGTTGTCGGANAA
ACCCCTTGGTCCCTCCAATGCGTACTTTGCGCCAC
page-top