Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8h13
Contig Information
Length 599 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8h13   
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 208
Evalue 4.09428e-15
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8h13
ATTTGGTAGTAAGGAGATACAGTAGTAAAAGGACATATCACACAGGCTCCGTACAAAAAAAACCTCATTTTAACCACTGCCCTTTGTCTTAATTTTTATT
GGCATACAATACAATAATAATTCACCATAAGATCAATTATTTGGTGATCCACGTATAATTTCCATTAAGGCTACTCCATTTTCTAAGATATAGTAGGGTA
ACTCGATCGTAACTAACTAGTGTATTCATCGCAACTATATATATACTTGCAATGCAATATAGTGATGATGAATGGACACGTGCATGTCCGGCCAGCCCAT
GATGGAACGATCAGTCAGACGTTGGCGGTGGCGGCAGCGGTGGCCTTGGCGGTGACGGCGGCGGCAAGGCCGAGCTCGGCGAGGTGGAGATCGGTGTCTT
CCGGGTGTTCCTCAACATTCCTGGGGCGATGCGGCAGCATCCACCGCCCGTCCTCGGTCCTGACCATGCCCTTGTTCAACTCCTGGCGCCACCCGTCGGG
CACCATGTGCTCGTCCATGAGGAAGTCGGCGGCCTTGTTGACNANCGCGGGATCCCTGCCCCCGANCTTGAACTCCTTGCCGCGGNCCTGGTAGCCGNC
page-top