Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20h02
Contig Information
Length 368 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20h02   
Homology (BLAST) Top Hit hypothetical protein CHLREDRAFT_142416 [Chlamydomonas reinhardtii] >gi|158282604|gb|EDP08356.1| predicted protein [Chlamydomonas reinhardtii]
Score 87
Evalue 0.2411
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20h02
ATAAAGCCCGCGATACATCAAGATCGTGACATCTCAAGAACACGAGAGAGAGAGAGATTAAACACATAGCTATTGGTACAAACCCTCCGCCCCGAGGGTT
GACTACTCCCTCCTCATCATGGCGGCCATCGGGATGATGAAGAAGGCCACTGGTGATGATTCCCCCCTCTGGAAGGGTGCCGGAACGGGGTATAGATTGG
ATCTCGTGGATACAGAGGCCTTGAAGTGGTGGAACTTCTGATCTAAGGCTATCCCAAGGGTTTTGGAATATTTGGGAATTTATAGGGCGAAGAGGCGGTT
CAGGGAGCCCCCGATGTGGGCAGGACCCACCAGGGTGCGCCTGGGCCTCTTGGCGGCCTGGTGGNNNC
page-top