Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20h07
Contig Information
Length 152 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20h07   
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain clone 512; Short=RuBisCO small subunit >gi|21866|emb|CAA25057.1| unnamed protein product [Triticum aestivum]
Score 247
Evalue 6.9481e-20
Total Hit Count 418
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20h07
CATTGTCCAGTACCGGCCATCGTANTACCCAGGGGATGCGTTGTGCTCACGGAAGATGANCCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAG
CGGATCANGTAGTCNACCTGCTTAAGGAGGGCCTCCGNGCTGANCGGTGGNA
page-top