Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11c02
Contig Information
Length 785 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11c02   
Homology (BLAST) Top Hit hypothetical protein OsI_31553 [Oryza sativa Indica Group]
Score 912
Evalue 1.69799e-96
Total Hit Count 95
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11c02
ATATTTATCATCATAACAAAGGAACCTACAAAAGTATCACAGCTTCCATCTATACATTTTAATATACACCGCGGTTTCACAATAACGCCAGTGTCAGAGC
GAAAACCATTACATTATCAAATCAAAATTAATAGGATTCGACCAGAGTAAAATCTGCTTCGTCACCACGAATCACATGATTTCCTACTAACTACAATTTC
AGCTTTATCTTCTCGGACCATTTGAATATATCAGAATACACCTGATCACCACCAATTTCCTCACCGGTTGCCCCAGCAGCAATCCTGATAATATCCTCCA
TTAAAGCAAAGTTCCCCATAATATCAACGTGGGCACCACTCTGTGTGCCCCTTCCTTCAAGGAGATTCGAGGGTGGAGAATGATTATACTCTCTCACGTA
AGTCTTGCTGCCAGAAGGGTTGAAGCGAGTTTTTCCACGCCATGCTTTGGCACACATATACCCTGAACTAAGAACTGGAACAGTCTCATCACCATTCGAC
ATGTAAACACCACCTTTCAAGCAGCTATTCTCATCCCCACCCTCAGCTGAGGCATCTATCTGAAAGGGTATATAGCACTCTGCCTGTGGGGATAATTTAT
AGACATATGCTCTTTCGGTAGGAATGCCTACTCCATACATCGAAAATATTTCCATTTTAGGCGCATTTGGTAGTTTTGTCTCCAAGGGGTTTGACCAATA
CTTGTAGTGGCCATATTTTGGATCATCCAAGTTATCAGCAATTCCATATGGAAAAAATGAAACACTACCACGCTGCATCATCCTT
page-top