Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20j22
Contig Information
Length 651 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20j22   
Homology (BLAST) Top Hit hypothetical protein OsI_19263 [Oryza sativa Indica Group]
Score 451
Evalue 3.31868e-43
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20j22
TCATCTATGTTCTTCACCATGCCATTGATGCCTTTGCCCAAGTACCCTCCGTGGGCAGATTTCAGAAACTATAGTACTATGCACTGCAGTGCAAAGCTTC
TTGCATATATATGTGTTCAGACAGTACATATCGTATACGGTGAAGTGACACCGTCTTCTTCGATAGTGGCAAGAAAGTGTGTCACATATCATGAGTGATA
TATGCTACTCTGGAGCACTCCTTTTGATCACACAGCTTTATTTACAATCCACAATAGCAAAACACCAACTACCACTACAGTAAGTTTTCTGATACACGAA
GTAGAAGGGCTACGGCGCATAGGAAAACAATGGTGGCATCCATGACTGCATCTAGTCCCATCAACCGCGCCATCATCTCTGCGAGGGTTTCGCGCCCATG
CATCTCTACAAGATTCTTCAGTTTCATAGAGAAGTTCTGCTCAGCATGTTGGATACAGTAACGCAACATATCCAACACAGCTATATCAGTTTCATAGTCA
TCAGAACCTGGTATATCAAAAATTTGTTGGGGNGGAATGGCAAGTGTCTCTGCTAACTCATTCTGAACTTGGGAACGCTGTTGAAACGATAGTCTATCCC
CGTGAGTAACCACAACAGCAGGCTTGTCATCTCCCAAAGANAAGAATGGAT
page-top