Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20k15
Contig Information
Length 106 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20k15   
Homology (BLAST) Top Hit Hydroxymethylglutaryl-CoA lyase, mitochondrial precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|125535697|gb|EAY82185.1| hypothetical protein OsI_37387 [Oryza sativa Indica Group] >gi|125576143|gb|EAZ17365.1| hypothetical protein OsJ_031574 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 551
Evalue 6.80604e-55
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20k15
GGACACGTCGTTTCGTTGCCCTTGGTTATGGAGTGGACATAGTACAAGATATACACATCCTCGCAGTCGCAGACAACTGGAAAAAGAAACTATCTTTCTG
TGCTGC
page-top