Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10i13
Contig Information
Length 735 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10i13   
Homology (BLAST) Top Hit Os01g0556400 [Oryza sativa (japonica cultivar-group)] >gi|113532855|dbj|BAF05238.1| Os01g0556400 [Oryza sativa (japonica cultivar-group)]
Score 371
Evalue 8.07236e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10i13
TTTCCAGAAAGAGGTTGGGGTCGTCGCGTCGGCGTTGCCCAATCCTCTCCCATCTCCCCCACCTCTCCTACTCCGCTCCGCGCCGTTGCCGATCTGGCCT
CCAGTCAACTCCGGCGAGATTGGATTTGATTGGATTGAAGTTTACTGGACTGGAGCCGATCCGATCCGATCTGATCGGACTCTGCTGGCATCTAGCGAAG
CTTGAGGAGGGGTCGCTCGCTGTCGCGGGCCACAGATCTGCCGCGTCCGCCATGGACGGCAACAAGGACGACGCTGTCAAGGCCCTGCGCATCGGCAAGG
ACGCCCTCGACGCCGGCGATACCTCCCGCGCCCTCAAGTTTCTGTCTAAGGCCAAGCGGCTGGACCCCTTGCTCCCCATCGATCACCTCCTCAACCCCCT
CCTCAATAAGGATGACCCGTCCTCCTCACCGGCCTCGTCATCATCGTCATCTGCCCCACATCCCCCACCGCCTCCGCCGTCGCGAGCTGCATCATCAGCA
GCCGGTGCTGACGGCTTGAGGGAAAGGAAGCAGAAGGGCAAGAAGAAGGATGGGGAGGAGGGCGGCGGTGATACTGCTGGGGTGAGGACGTACACGGAGG
AGCAGCTGGAGGTGATCCACCAGATCAAGAAGCACACTAGGGATTACTACAAGATCCTGGGCCTCGAAAAGGACTGCACTGTTGAGGACGTGCGCAAGGC
CTACCGCAAGCTCTCTCTCAAGGTGCACCCTGACA
page-top