Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11b01
Contig Information
Length 813 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11b01   
Homology (BLAST) Top Hit Os01g0278600 [Oryza sativa (japonica cultivar-group)] >gi|56783742|dbj|BAD81154.1| unknown protein [Oryza sativa Japonica Group] >gi|113532273|dbj|BAF04656.1| Os01g0278600 [Oryza sativa (japonica cultivar-group)] >gi|215697805|dbj|BAG91998.1| unnamed protein product [Oryza sativa Japonica Group]
Score 564
Evalue 4.04502e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11b01
AAGCGGTGGATCACACAGGGGATCTGCAGCTAATTACAATGGCAATCCCACACACAAAAACGTGCCAACACCGGCGCACCGAGGGAGGCCACACCATTCC
AAGAGTCCACGAGGAGTCTCCGCTCTCAACCAAGTACTCCCTCCCAGCCTACTCACCCGACTCGGTCCACCCGTATGCGAGGTTTGGGTTTCGACATTAA
ACGTCTTATATTTTGAGACCGAGGGAGTACCTACCAACGCGGCGTGACATTTATTAGGCGAATTGTGTAGCTTGGCATAGGTGCAGGCCATCTGTTATAG
TTGTTCTCTCTCAGCATCTCTGCGGCTATAGTTTTTGACACCGTGCTGCCATCTCTTTGTCGCTTTATCACAACCTCAATTGTCATGTCCCCAGCCCAAC
CTCCAAAGGCTTCAGAATGAGCTTTTGCATCATCCAGTAACATTGCACCAAACTCTGGGACACTAGAGAGAAGTTTGTCACCACATTTTACAAGAACATC
ACCGACACGTAACCCAGCAACATCAGCAGGTGATCCCTCAACAACCTTTGAAACATATAAACCCTGGTCAACATCTGGGAATTTTTGATAGATAGGCTCC
AAGACGGCCAGTGGAACCATATGAAGAGAACTGTACCTTAATCCAAGCCAGGGGCTAATTAATTTCCCGAAGCAGTGATGTTGTTCCAGGATCCTTGATA
CAATTAACATGGGAAGGTATGATGTTTGATTCTTTTCGTAGAAGTTGATACCAAGAACTTGACCGTTGTAATTGACAAGAGGTCCTCCAGAAACCANCCA
TGGAAACCTTGCA
page-top