Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10i08
Contig Information
Length 496 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10i08   
Homology (BLAST) Top Hit hypothetical protein OsI_21023 [Oryza sativa Indica Group]
Score 582
Evalue 1.03249e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10i08
AATGTTGGCCTATGTGCTAGGGATGTTTGTTTCTTGGAGGATGCTTGCATTGATAGGAACCTTGCCATGCACAATATTGATACCTGGCCTATTCTTCATT
CCAGAATCTCCAAGATGGCTGGCAAAGATGAACAAGATGGATGATTTCGAAGCCTCTCTACAAGTTTTGAGAGGATCTGAGACCGACATCACCTCAGAAG
TGAATGATATAAAGATAGCGGTAGCATCAGCAAACAAAAGGACGGCAATCCGTTTCCAAGAGTTAAATCAAAAGAAATTCCGCATGCCCCTGATACTAGG
AATTGGCCTGCTTGTACTGCAACAGCTAAGCGGGATCAGCGCTATACTGTCTTATGCAGGCAGCATCTTCAAAGCTGCAGGTCTTACAAACGGCAACTTG
GCCGCATGTGGACTTGGAGCTATTATGGTTCTTGCCACTGGAATTACAACCTGGTTACTCNACANAGCTGGCANACGGATCCCTACTTATTATCTC
page-top