Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20m15
Contig Information
Length 646 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20m15   
Homology (BLAST) Top Hit PREDICTED: similar to ankyrin-repeat and fibronectin type III domain containing 1 [Ornithorhynchus anatinus]
Score 88
Evalue 0.405695
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20m15
GTTTTAGTTGGTTCTATGTTGCTCTAGATTCAACTACCACAGAAAAACATCAAACCAAATTTCAGGACTACCGAAGAAGTTGTGATTCGATCGGCTGGGA
AGAAACAAGCAAGCTAGATACATACGTGATGTTTATTTCCTGTAGTTCTTGCATAGTCCGAAGGGCAGTGATAGGCGCCGGCAGTCCGGCGAACAGTTGG
ACCGGACTAGCCCCAACCGCCCGATCAAGCGACTACGAGTCGTTCGATCCCTGATCCCCGCGTTGACTTTTTCTCTCCCTCTTCCTCTCCATAAAGCCCG
GTGGCCTCGACGTCCTCCCGGCCGCCGGCCATCACCCACTCACTTGGACCTCCTCTCTCCGTCGCCCCTGCGCTGCTGGATGCCGCGCTCGCCGCCAGTC
GCCGCCGTCTTCTCCCATGTTTCTCGTTGGGATCCACGCACAGCAAAAACTTCGCCCGTGGGTTGCAGCTTCCCTAGCTGGTGATGGTCGCGGCTCCGGC
AACGCCAGTCGCCGGTTGCAGCTCCGTGTCATCCTCGCCGCCGATGCTCGCAACAACAAAAAATTGTCAAAAAAGCACCTCTGTGTCACCGCACCCTGTT
GAATCTTTTGAAAACGTGGTTCCAGCAAATTGAAGTTATGGNTGNA
page-top