Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11a18
Contig Information
Length 841 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11a18   
Homology (BLAST) Top Hit Os05g0101600 [Oryza sativa (japonica cultivar-group)] >gi|57863894|gb|AAG03095.2|AC073405_11 unknown protein [Oryza sativa (japonica cultivar-group)] >gi|57863848|gb|AAW56889.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113577932|dbj|BAF16295.1| Os05g0101600 [Oryza sativa (japonica cultivar-group)] >gi|215704858|dbj|BAG94886.1| unnamed protein product [Oryza sativa Japonica Group]
Score 207
Evalue 3.31105e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11a18
TGCATTCTCTCTGGTATATGTATATGCAGTCAGTTCAGCTGGATCTGGCATCCAAGCACAATGATGCACCTCTTACCCTACAACATCTGAACACCATGGA
CTACGCATACAAGACGGTCAAAGAATCTCTGAGGATGGCCACCATAGTTTCTTGGTTTCCAAGGGTGGCACTCAAGGACTGCCGGGTTGCAGGTAACTAA
ACCTCTCTGATTTATTCTTCCTCCTCGCTGGAAGCTACTATTGACAGAGACAAGTAACAACAGGATTCCACATTAAGAAGGACTGGATCGTAAATGTCGA
CGCGAGATCCATACACTATGATCCGGCCATCTATGACAATCCGACGGTGTTTGATCCTTCCAGGTTCAACGTATGTATTCTTGTAAGCCTGAAGAAATTA
TAGTAGATATTTATTGTTTTGTGATGTAGACAGATTGATGTTGTTGCTATGGACAGGATGATATGAAGCCATACAGCTTCTTGGTATTTGGAGCAGGCAG
CAGAACATGCCTGGGGATGAACCTTGCCAAGATTATGATGCTAATATTCCTTCATCGCCTTGTCACAAATTTCAGGTTTCAACTCTAAAGCCAAGTTTCT
TTATTTGATGCAAACAGATATGAGCTGGAGACTAAAATTAAAATTTCTGATGTTTTCAGATGGGAGATGGCAGACCACGATACAAGCCTTGANAAATGGG
CAATGTTTCCGAGGCTCAAGAAATGGCTGCCCAATTCAGCTCACGCCGATACNCAAGGACCAANATGCACTGATGACTGATGCACATCTANTAAAATCTG
TCANGATATGCATCCNATTATGAAGCTATATGATTTTCCNT
page-top