Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11a19
Contig Information
Length 684 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11a19   
Homology (BLAST) Top Hit hypothetical protein OsJ_035429 [Oryza sativa (japonica cultivar-group)]
Score 605
Evalue 5.11534e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11a19
ATACAATAATCCCACAAAACACACGAACTGTTCGTACGAAGTACCAACGATACAAGATGAAGATAAACGCCCAGCGCCAGTTCTCACGTCTCCAAGCTCC
CACAGAAGACATCATCGTTGTCACCATCACCGGCCGGATGCATCTCAATCCTGCACAGCACCTGCAGCCGCTCCGCGACTTCCTTCATCGTCGGCCTGTC
GTCTCCTCTCGCGCTCAGGCAGTGCACGGCGAGGGCCGCGAGCTTCTCAACGACCACCATAGCGGCAGCATCCTCTGCGATCTCAGAGTCGAGCATCTTC
AGGTGCATGTTCTGGTGGAACATCAGGAGAAAACTATGGGACAAGGATCTCTTCTCTTTGGAGGAGCTATCGGCATAGAGAGCCCTCTTCCTCGTTATCA
GCTCAAGGAGAACGACCCCGAAGCTGTAGACATCGCTCTTGTCGGTGAGGACATGGCTGATGAAGCTCTCGGGGTCGAGGTAGCCGAGGGTTCCCTGGAC
GAGCATGATGAACTCGCTTTCGTCCATGGACTTGAGCGCCGATGCTCCGAAGTCTGCAACCTTGGCGTGGCGCTGATCGTCNAGCANAATGTTGGCGGAT
TTGACATCCCCGTGCAAAATTGTGCGGGATGTCNACNAGTGCANGTAANCNAGANCTTCTGCTGATTGTGTNNCAATCTTCANG
page-top