Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd8c02
Contig Information
Length 506 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd8c02   
Homology (BLAST) Top Hit hypothetical protein OsI_03627 [Oryza sativa Indica Group]
Score 568
Evalue 4.52883e-57
Total Hit Count 81
Registered year 2003
Contig Sequence     [ Download ]
>whvd8c02
CACTCAGCACCTTCNTCACCATCCGTTGAGTGTCTCAGGCTCTCAGCGTGCGCGTCTGATCTGATGGCGGCACCGGCAGGAGATTCCTCCGGCGGCGACA
ANATACAGGTCTCACCTGGCCGGCGAGGGCGANAAGAACACCGTGTGGCGGCACGGCGCGCCGCCCACGTACGACGCCGTGAACANCCTCTTCGANGCCG
GGAGGACTCAGGAGTGGGCGAAGGGGTCNCTGGAGGANACNGTGCANAACGCNATCAAGACGTGGGAGATGGAGCTGTCGCACAAGGCCCGCATCGGGGA
CTTCAAGTCGGTGAGCCCCGGCCGGTTCACCCTGTCCGTGAACGGNGGGCGGGCCCTGACGGGGGAGGANACGCTGGCCATGGGCAGCTACAACGCGCTG
CTCNCCAGCCCGATCCTGCCGGCCACGGGCGCGTACNACGCCGCCGCCGAGACGTTCGAGTCCTCGNACGACCTGTTCCNCTCCGCCTTCCCGCGCGGCT
TCNCGT
page-top