Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20m19
Contig Information
Length 604 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20m19   
Homology (BLAST) Top Hit hypothetical protein OsI_09046 [Oryza sativa Indica Group]
Score 680
Evalue 7.70414e-70
Total Hit Count 109
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20m19
ATGATCTGTTTATCACTATCTACAGTTCTGATCAAATGCATGAGAGGAAAATAAAATACATTCATGGAACATATTTTTCCTGTAAATTAGAAAGAAGCCT
ACCTTATCTTAGCAAACAATTGTGTTACCGTGTGAAGAAAAGAAAAGAAAACTTACAGCTACAACCGAGTTTCATTTACAATCTTGAGCCCCCAGCTGAC
GTCTTCGCAGTGCCTCACGTACGGCACCACCTTGCCCAGGTCGGCGTCCCTCTTCGCCCTGCAGTCGAAGTAGGGGGCCTGGTGGAAGCACGGCTCGATG
GACATGGCACGGCCGCACGGCGGCTCCGGCACGACGTGGTTCTCGGGCCTGTACATGATCCACGGCGTGAGGCCGGCGAGGCCCTGCGCGACGTACCCGA
AGGTGGAGAAGCCGCTGGTGATGAGCACATCGCTCATGCTCAGCAGGTAGATCTCCGCCAGCGCCTTCATGTTGTGCTTCCTGTTCTTCTTCTTCTGGTA
CTCCTCGTGGCTCGGCTGGTAAACTTTCACCATGGTGCCGTCGACGGTCCGGTGCTCGCTGTACCTTTCCCTGATCTGATCACTGTACCAANAGCTCAAA
GAGG
page-top