Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10h15
Contig Information
Length 696 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10h15   
Homology (BLAST) Top Hit hypothetical protein OsI_18343 [Oryza sativa Indica Group]
Score 630
Evalue 6.62454e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10h15
GCCGCGCTCGCCACCCCCATCCTCTCCTCCGATCGTCCCCCCACGATCCCGCGCCGGAGCTGGGGAGGGAGGGGGGAAATTCATCCCCGCGCCAGGCGGA
TTCCGCACCGGATCCCCGCGTCGGGCAGGCCGGCCTTCTGATCCGGCAGGTTAACCAAGTACGGTGCATTCTGAACGGTAGCCTGTAACTCTTATTGGGT
AATTCTACCACATTATGGCCTCGGTTGGTGTGGTGCGTCCTTCCTCGCGCTTTCAGAATGACACGAGTACTAGTGGTGATGCCGACCGACTTCCGAACGA
GATGGGCAATATGAGCATAAGGGATGACAGGGACCCTGAGGATATANTAGTCAACGGCAATGGGACGGAACCANGCCATATTATAGTCACAAGCATTGAG
GGAAGAAATGGGCAAGCAAAACAGACCATTAGCTACATGGCTGAGCGTGTGGTTGGTAATGGGTCATTTGGAACTGTTTTCCAGGCTAAGTGTCTTGAAA
CTGGCGAGACGGTGGCTATAAAGAAGGTTCTTCAAGACAAGAGATATAAGAACCGTGAGCTGCAAACGATGCGAGTTCTTGACCACCCAAATGTTGTGGC
TTTAAAGCATTGTTTTTTCTCAAAGACTGAGAAAGAGGAGCTTTACCTCAACCTGGTGCTTGAGTATGTGCCGGAAGACTGCTCATCGTGTCATTA
page-top