Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20n11
Contig Information
Length 600 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20n11   
Homology (BLAST) Top Hit mitogen activated protein kinase 7 [Oryza sativa (indica cultivar-group)]
Score 478
Evalue 2.01321e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20n11
TAGTCCATATACATAGAGCAGTGGTCTAAGATTACAAACTTACAATCAAGGGAAAAAAAAGATTACAACTTACACAAGCTTCTTCATAACCGAATTCCGC
TTCTACAACACAGCAGTCCATATATACTACCAAGTACTGACCCACAGCTAGAGAAATCCATACGCCGTTTATTGTGCACATATTTACATAAACAGGTCAC
TCGACGGCATTGCGATAATTGCATTAAAGCTTTATACCAAGAACGAACATGTGAAGACCCTGGTGTGGCACACTGCTCTCACATGTTCATTCCTGCTTGT
CACATATTCACCATCCTGGCGGCCTCGGGGTGGTACTGGAGCATCTCCTGCCACAACATTTCTCGGATCATATCTGTGCCAATGTTTTCATCTATGTCGA
GATCGATGGGCACCTGCGCAGGAGGGTTTGCGCTGGGATCATACAGCGGGGACATGTAGGGGTGCTCCAGAGCCTGGGTGACACTGATCCTTTTGGAAGG
GTCAAAGACAAGCATCTTCTGCAACAGGTCAATGGCAAGAGGGTGCGCTTGCGGGTACATGCTACTGAGGGGAATCCCTGGGGTGTATGGAAGGGATTTA
page-top