Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20o06
Contig Information
Length 738 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20o06   
Homology (BLAST) Top Hit hypothetical protein OsI_38512 [Oryza sativa Indica Group]
Score 576
Evalue 1.37949e-57
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20o06
AAGTCTTTCGATTCGGTAGTCGAATAAGTTAAGTAGCAGGCAGCGTGTTCAAGGCCAAAATGTTCTAGTACTATTATTAGTATCACCACAACCCTATCTA
GAATAAGTTCGCACGGCTCATCATACATGCCGTGTAAACCGATTCCGACATAAATAAAAAGGAACAAGCAGAGAGCTTGGGATAGCACCCGCGTACGCAC
TTGACATCGACCCTGATGGATTCCCACGATGCGGATTCTCACTTCTGCTGGCCAGCCTCGACGGGTTCCACCACCTCGGCTTCAAGCGGCTCAGGTTCAG
AGCTACTAGGTGCAGCAGGCTGCTGGCTTGGCTGGGCAGGTTGGGGCTGCGACGCCCACTTGCCCGCCATAGCTGTGCTCATCATGTCATAGATCTTCCC
GCTCAGGTCAGTTGGGTTATCAGGCGTGAAACCGCTAGAAATCATTGAAGTTTCAAAGAGGATGTCGATTGCCTTTANAGCTTCTGGGTCATCAGGGTTG
ATTCTGCACGCAGCATTCAATCGCTTGATTATCTCATGCTCTGGATTTATTTCAAATACTTTCCTGGAACGCATGAAATCCAGAGAAGACGTATCACCTA
TANACTGCGCCCTCATTAACCTTTCCATATTGGCTGACCAACCAAACTTGGCTGCAACTANAACACATGGTGATGAGCTGANACGGNTGGATACATCAAC
TCNAGCAACCCTCTCACCCAAACGTTTCTTGATCCANT
page-top