Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8i10
Contig Information
Length 322 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8i10   
Homology (BLAST) Top Hit predicted protein [Trichoplax adhaerens] >gi|190585159|gb|EDV25228.1| predicted protein [Trichoplax adhaerens]
Score 88
Evalue 0.189529
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8i10
TGATTAATCAGACGGAGAGAAAACAGTTACAGAGTTACAGAACAATGAAACGCCATCTATGGCGATACTACAAGCATCCCTGTTTCAGACGGAGCAGTCA
CCATAAGACGACATCGATGACCCACCAAATTCATCGTTACCATATAACCAAATCGCATCAACGTAGCGCCTTTCTCAGGAGGCAGATACTAACATGGTTC
AGTAAAGAGAACCGGCAGGAACGCGGACCTGCTGCGGTGGCGGAGGAGGGCAGGGAGCGGAAATCGGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTCTNTCTNNC
page-top