Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10g23
Contig Information
Length 738 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10g23   
Homology (BLAST) Top Hit Os06g0581300 [Oryza sativa (japonica cultivar-group)] >gi|55297037|dbj|BAD68607.1| unknown protein [Oryza sativa Japonica Group] >gi|113595978|dbj|BAF19852.1| Os06g0581300 [Oryza sativa (japonica cultivar-group)] >gi|215678591|dbj|BAG92246.1| unnamed protein product [Oryza sativa Japonica Group]
Score 849
Evalue 3.97297e-90
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>whvd10g23
CGCGCGACCATGGTCGGCGGCAGGCTACCCTAGATCGTGTACAGGGCGGNGTTCGCCGCGCTTGGCTGCCTCATGGATGGGCACCCTGGTGTACACCTGC
ATCACCGACGGCTCGCCGTTTCGCACCGAGCTGCTGACCCCGTGGATGGTGACAACACTGGTTGATCTTTATGTAAATATAGCAGCGATTTCGACTTGGG
TTGTCTACAAGGAAGGAAATTGGATTACTTCTATCTTCTGGGTAGTATTGTTGATTTGTTTCGGCAGTGCCACTACATGTGCTTATATTGTTAGCAAGTT
ATTTGAGATAACATCTTCAGGGCTTTCCCAAAATCCGCTTGACCTTTTGTTGCTCAGGCAAAATAATCTACCTGAAAGGAAGTGTTCTTTTGTCGTCATC
GGAAGAACTATTTTCANCATTCTGGGCATACTCATGGCTGCACTTGTCACGTATACTGTCATTACAGATGGACTGCCTTTCAGGAAGGATTTGTTGACAC
CGTGGATGGCTGCAACCTTAATTGACTTCTATATAAATGTTTTTGCAATATCGGTATGGGTTGTTCACAGGGAGTCGACTTGGATCTCAGCAGTCATTTG
GATATGCTTGTTGATATGCTTCGGAAGCATCACAACATGTGGCTACATTGTGGTTCAACTTCTCCAAGTGTCATACCAAGACCCAGTCTACCATCTGCTA
CTGAAACTCCCATAGCAAGTATGGNAATCGCACCCCTT
page-top