Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20p03
Contig Information
Length 756 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20p03   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195659551|gb|ACG49243.1| AKIN gamma [Zea mays]
Score 682
Evalue 7.32684e-70
Total Hit Count 411
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20p03
TTTGCACCAGGGNAAACAGGGTGCGGATCAGCGAACTCGGGAACTCAGCACAGCAGTTGACAAACTAAAGCACACACTAACAAAGCACTGAAATGCCTTG
TCACCCCACACAGAATTGACTGTATAAACACCGCAACCTGAACGAACCAGTCCAGCTACAAGACTTGCTCACTAACCCTGTCTGTTATTTCCACCGTCTT
GCGCTCCCGAGAGCTCAGCTGTTCCCAATGGAGGGCTCAGCTGTTCTCAACGGAGGAATCGGCATCGCCCTTGTCCTCGAGCTTCTCCATCGCTGAAGCA
AGATAACTGTCGCAGAAGCCAGGGGGCTCGTGGATGAAGCAAGAGATCACGTCTCGCAGTGTCACAACACCAACCACCTCAAAGTCACCATCCACCACGT
ATATCCGGTGGGTTATCCTCGATCCGATGCTGTCGATCACGCTGCCCATAGAGGCATCAGGTGCACAGGTGAGCGGCGGCTTCACCAGTCCGTTGCCCCC
TGAATCAGGAAGAGTGGAACCTAGAGCATTCATGAACTCCAAGACGGTAAGATGCCTGAAATCAGAAAATAAGTCAGGCCTAAGCAACAGGAAGCGAATG
TCCCTTATGCTCACACTACCGACCAGTTTCCTTTTGGGACCTTCTACTACAGGTACGCCGCCAATTTTGTTATCCTTCATGCACTTGAAAGCTTCTAAGA
TTAGATCATCACTGTTAACCGTAATAACCTCATCAAGAGACATGAATGGAAGCCCC
page-top