Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd15d06
Contig Information
Length 160 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd15d06   
Homology (BLAST) Top Hit hypothetical protein OsJ_009224 [Oryza sativa (japonica cultivar-group)]
Score 219
Evalue 1.21882e-16
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>whvd15d06
CCGTAGAGGACATGGATGATATTATTNGANTCCAGGATTATTTTGACANAAAGAACGAGGCAAAGAGCCAGTTACAGTTGACAAAGGCTACTGAATCAAA
GGTTGAAGNTGTTGGTATGGGCGATCGTGTTTGTGTGGATCTCTGTAGTATCATGCGACC
page-top