Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10a15
Contig Information
Length 195 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10a15   
Homology (BLAST) Top Hit hypothetical protein OsI_38147 [Oryza sativa Indica Group]
Score 114
Evalue 0.000182196
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>whvd10a15
TCTGGAGACCACCTCACACAGAAACAGAGGCCCCTTCTTCCTAGCTGCTCAATCCTCCATAGATGGGTTCCCTGCGGAGCAGCACAAGCACGGCGGATGG
AGAGCGTGGACGCAGAGGCGGCGTGCGGGCTGCTGGCCTTGGAGCAGTACGGGTACGTGGACNTGCGGATGTGGGAGGACTTCGAAAAGGGCNAT
page-top