Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10a17
Contig Information
Length 763 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10a17   
Homology (BLAST) Top Hit hypothetical protein OsI_13471 [Oryza sativa Indica Group]
Score 326
Evalue 1.43314e-28
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>whvd10a17
AAGGCCAAGGCTAACTAAAGAATTAGAAGCGTTCTGGACAGTGGACGAGCCAATTACAAGGCTGAAGTTGGGGATCACATCTGATGCTCATGCAGAGAAA
CTAAGATTTCTAATTGATCTATTCTACCAGTGCACCAGAGGAACTGCATCTAGGCGCCCCAAGGCCGAGCAAATTTACAATTCGCTTTGCTCCTTACCCA
CATGCTATGACCTGAGCTGACCCCGTGGATTCTGAATGAGAAAGCTGATGGTTAGGCAGTCTCGCTGCCAGATCGGCCTCGGTCAGGACAGGTTAAACGG
GACAGCTATAGCAGGTCATTGGATCTGGCCAGCTTCTGAGTGCCTCGGGGCTCGAACCAGAACACTCCGCATTTCACTGATGTTGGTCTTCGGGTGGTGG
CGGAAAAAGTCAAACCAAGGCGATGGGCGACTTTGGCCGCTGAAGCTCCTCCTGGGTCAGTTTTGCAGCAGCGCTGCATGCTGGCTTCACCTGTTGTAGC
AGTCTCCATCCTGGTCGTGTGTGTATGTGTATGTCATGTAATATTTTTCTTCATAATTTGCAATTTTCCATAACTTATTATTCAATCGAGTCTTCTAAGT
TATCGATTTAGGTCAAGGCTCCATTTTTATGTATCTGTGTACGTACGATTGTCGGTCCAGCGGTGAGCCATGTAACTTTAGAATGCTGAGTTGTGTAACA
AACGGGAACGGGACAATTTTTTAACAGAGGCTGTGTGTTATGATTTCCCTGCCAAAAAAAAAA
page-top