Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10a21
Contig Information
Length 790 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10a21   
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group]
Score 103
Evalue 0.0110205
Total Hit Count 173
Registered year 2003
Contig Sequence     [ Download ]
>whvd10a21
CGCTCGATCCCCTCGTCTCTCTTCTTCCCTCGCGTCGCAGGAGAGGCCTCTGCGCGATCCCATCTTCCTCTCGACCCATCTCCCCTGCCTTCTTCCTCCT
AGCGCCGTCACCAGGGAGCACACGCAGGCGCATCCATCTCTCCCGATCCCCTTGCTCTAACCCTGCCCCCTCCATCCTCGCGAGATCGCCGCCTCCCTGC
CGCCGGCGCCTGTTCCCGGCCGGATCCGCCAGCCTCATCCCTTCCCCGCCTCGTCCTCCAGGCAGCAAACTCCGGCAGCCCCATCGCCCGTTCCTCCCTC
CACGCTCGCCTCCTCTCGTTTGGATCGAGCAGGATCCCTTCCCGAGCGGAGCGCTCGCTTCAGCCATCGGCTGCGAGCTGCGGGTCACCGGAGCAGCTCC
AGGCAGCTAGCCCGCACGCTGGGGACCCTCCTCTGCCGCGCATGCTCCTTCCCTGAGCTCCACCTCGCCGTCCTTCTGCACATCGTCGCCGGCCCCATCT
CCACCTCGCCGGACCGCCCCAACCCCGTCGTCATCCATGTGCCCTTGCAGGAGGCCACCACCACGCCTGCTTTGTCTCTGTGCACGCCTTGCACCGAGCT
CCACCACCGTTCGATATCCACCTCGCCATGGACGGGGCTGCTCCCAGCAGCAGGCTTTCTCCCTCACCTCATATGCCGCCTGGCTTGCTCGTTTGGTTGC
CACCCGCCTGGCTATGCATCTTCGTGGTTAGCGCCTTCGTCGAATCCTCAGGGGTCACCTTCAGTAAGTGGTACCCGAAGTGCAACAATC
page-top