Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10e19
Contig Information
Length 787 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10e19   
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 1267
Evalue 1.16234e-137
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10e19
CGCTCGTCGAGGACGGCGGATTGCCGCAGGGCGCCGCCGCCGACCCCGCCGGCCTCATCAAGGAGGCCATCCACGTCATCAGCTGCGGGTACGAGGAGAA
GACCGAGTGGGGCAAAGAGATTGGGTGGATCTACGGGTCGGTGACAGAGGACATCCTGACGGGGTTCAAGATGCACTGCCGTGGGTGGAAGTCTGTCTAC
TGCACGCCCACGCGGCCAGCGTTCAAGGGATCGGCGCCCATCAACTTGTCGGACAGGCTTCACCAGGTGCTCCGGTGGGCGCTCGGCTCCGTCGAGATCT
TCATGAGTCGCCACTGCCCGCTCTGGTACGCCTACGGCGGCCGTCTCAAGTGGCTCGAGCGCTTCGCCTACACCAACACCATCGTCTACCCCTTCACCTC
CATTCCCCTCATTGCCTACTGCACCATCCCCGCCGTCTGCCTCCTCACCGGCAAGTTCATCATCCCCACGCTCAACAACCTGGCGAGCATCTGGTTCATC
GCCCTGTTCATGTCCATCATCGCGACGGGGGTGCTGGAGCTCCGGTGGAGCGGGGTGAGCATCGAGGACTGGTGGCGTAACGAGCAGTTCTGGGTCATCG
GCGGCGTGTCGGCGCACCTGTTCGCCGTCTTCCAGGGCTTCCTCAAGGTGCTGGGCGGCGTGGACACCAACTTCACCGTCACCTCCAANGCGGGCGCCGA
CNANGCCGACGCCTTCGGCGACCTCTACCTCTTCAAGTGGACAACCCCTGCTGATCCCACCCACCACNCTCATCATCATCAACATGG
page-top