Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10b06
Contig Information
Length 772 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10b06   
Homology (BLAST) Top Hit cytosolic glutathione reductase [Triticum monococcum]
Score 1291
Evalue 1.8565e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd10b06
CAGCTCCGAGTGGCTGGGAGGCCACGGCGGAACGTGCGTGATACGTGGCTGCGTCCCGAAGAAGATACTCGTCTACGGGGCATCTTTCCGGGGGGAATTC
GATGACGCCAAGCAATTCGGGTGGGAGATCAACGGGGACATCAACTACAACTGGAAAAAGTTGCTGGAAAACAAGACTCAAGAGATTGTGAGATTAAATG
GAGTGTACAAGAGAATCCTTGGTGGTTCTGGTGTGACCATGATTGAAGGGGCAGGAAGTATAGTTGATGCTCATACTGTCGAAGTCACCCAACCAGACGG
TTCAAAGCAAAGGCACACGACCAAGCACATATTGATTGCAACTGGTAGCCGGGCAACTCTGGTCAACATTCCTGGAAAGGAGCTGGCTATTACTTCAGAT
GAGGCTTTAAGTTTGGAGGAGCTACCGAAACGCGCCTTGATTCTTGGTGGCGGATATATTGCTGTTGAATTTGCTTCAATCTGGAAAGGGTTGGGTGCTG
AAGTAGATCTATTTTATAGGAAAGAGCTTCCTCTAAGAGGTTTTGATGATGAGATGAGAACAGTTGTTGCAAGTAACCTTGAGGGAAGGGGAATCAGATT
GCATCCGGGGACCAATTTGACTGAGTTGAGTAAAACGGCCGATGGCATTAAAGTTGTGACAGATAAAGGGGATGAGCTCATTGCANATGTTGTTCTTTTT
GCTACAGGTCGTGCGCCGAACTCCAATAGGCTGAACTTGGAANCTGTTGGTGTTGANGTTGATCAAATANGA
page-top