Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10c11
Contig Information
Length 695 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10c11   
Homology (BLAST) Top Hit Os01g0164600 [Oryza sativa (japonica cultivar-group)] >gi|15528748|dbj|BAB64790.1| putative senescence-associated protein [Oryza sativa Japonica Group] >gi|21327992|dbj|BAC00581.1| putative senescence-associated protein [Oryza sativa Japonica Group] >gi|113531634|dbj|BAF04017.1| Os01g0164600 [Oryza sativa (japonica cultivar-group)] >gi|125569151|gb|EAZ10666.1| hypothetical protein OsJ_000491 [Oryza sativa (japonica cultivar-group)]
Score 337
Evalue 2.80549e-65
Total Hit Count 177
Registered year 2003
Contig Sequence     [ Download ]
>whvd10c11
CGCCTCCCCCATTTGCCGCGGGCGACGGAGGATAGCAGCGCANCGGCACAGCAGCCAGAAGACGGCCATGGCGGCTTCCACCGCGTCCCGCCTCTCGCCC
CCTTGCCTCCACGCTGCTCCCCACCACCCGCTCCGCCGCTCGCGTTTCTCCCCTCTACGCGCCGCCAAGTTGGAAGCTGTGTTATCTATTGGAACTCATG
TAATCCCACACCCGAGAAAGGTTGAGACCGGAGGAGAAGATGCTTTCTTTGTGGGCGGTGATGGTGGTGGAGTATTTGCCATTGCAGACGGNGTTTNAGG
CTAATCATTCTCTTATCTACTGACAGATGGGCAGAAAAGAATGTCAACCCAGCTCTGTTTTCTCGAGAGCTTATGGCAAACAGCTCTACTTTTATCAAGG
ATGAGGAGGTCAGTCAGGATCCTCAAATTCTTCTGATGAAGGCTCATGCTGCAACTTCTTNCATCGGATCTGCTACAGTAATCGTCGCGATGCTTGAGAA
GACTGGAACCCTGAAAATTGCGAGTGTGGGCGACTGTGGTTTGAAAGTTATTCGTAAAAGGGCAAGTGATGTTCTCTACATGCCCGCAAGAACATTACTT
TGATTGTCCATACCAGCTAAGCTCCGAGGCAATTGGTCAAACATCTCAAGATGCATTGGTTTGCACTGTAAATCTTATGGAGGGTGATATGATAG
page-top