Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2349
Contig Information
Length 683 bp
Tissue Seed DPA20
Clones 9 Clones [Download: CSV  ,  FASTA ]
whdp2i18    whdp8n02    whdp13l09    whdp18f03    whdp19k22    rwhdp10f14    rwhdp2i18    rwhdp8n02    rwhdp18f03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleoside diphosphate kinase [Lolium perenne]
Score 750
Evalue 7.85532e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2349
TGCAGGCAAAACCCAATCAGAAATCTCAAGCTCAGCACAGCAACAATGGCCGAGCAGACCTTCATCATGATCAAGCCTGACGGCGTCCAGAGGGGCCTCA
TCGGCGAGGTCATCAGCCGCTTCGAGAAGAAGGGCTTCTACCTCAAAGGTCTGAAGCTCCAGAACGTGGAGAAGTCGTTCGCCGAGCAGCACTACTCTGA
TCTGTCCTCCAAGCCCTTCTTCGCTGGGCTCGTGGAGTACATCGTCTCCGGCCCGGTCGTCGCTATGGTCTGGGAGGGCAAGAGCGTCGTCGCCACTGGA
CGCAAGATCATTGGCGCCACCAACCCCCTGGCCTCTGAGCCCGGCACCATCCGTGGTGACTTTGCCGTCGACATCGGCAGGAACGTCATCCATGGAAGCG
ACTCAGTTGAGAGTGCCAGGAAGGAGATCGCCCTGTGGTTCCCTGAGGGCATTGCAGAGTGGAGGAGCAGCCAGCACAACTGGATCTATGAGGCATAAGA
TGTGTCATGAGTGGTTTGAGTGCAGGTTTCATTAAGCATCTACCAAACTAGTCTTTGGTTGTTTACAGTTTTGAGATTTGTATCTTGGGAACCTTGTTTG
TGTGAACTGAAGTTATCTCCTTGTGCTTGAGCATGCAAGGCGTTATCTGCTGCTCTATATTTGATATATGGTATTGANTTGCA
page-top