Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2335
Contig Information
Length 706 bp
Tissue Seed DPA20
Clones 9 Clones [Download: CSV  ,  FASTA ]
whdp10a03    whdp15l06    whdp16e23    whdp16e24    rwhdp10a03    rwhdp2n17    rwhdp15l06    rwhdp16e23    rwhdp16e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small heat shock protein 16.9 kDa [Triticum aestivum]
Score 605
Evalue 5.4064e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2335
TCGCCAAATCTGTTTGACGATTACACAAGTACAGACACAACAGGGAGAAGAAACGCAATACAAGTACAGATGCCTCGCCACACTCGATCAGCAAGAACAA
GACACAACTATAGCATACTTTTAGGTGGCAGAGCTCGCACACACATGAACCAGACAGGCTCTGACCCGAATACTCAGCCGGAGATCTCGATGGCCTTCAC
CTCGGGCTTCTTGACCTCGGCCTTGGGCACGGTGACGGTGAGCACGCCGTTCTCCAGCCCGGCCTTCACCTCCTCCACCTTGGCGTCCTCGGGGAGGCGG
AAGCGCCGCACGAACTTGCCGCTGCTGCGCTCCACGCGGTGCCACTTGTCGTTCCTGTCCTCCTTCTCCTTTGTGCGCTCGCCACTGACGACGAGCACGT
TGCCGTCCTCCACCTCCACCTTGACCTCCTCCTTCTTCACGCCGGGGAGGTCGGCCTTGAAGACGTGTGCCTCAGGCGTCTCCTTCCAGTCCATCCGGGC
GTTCGCGAACGCAGCTGTCTCATTGTTGCCGCCTGAGATCGCCGGGACGATGGAGCGGAAGGTGTCGAAGGGGTCGGCCCAGAGGTCGGCGAAGGGGTCG
AACACATTGCTCCGCCTCACGATCGACATTGTCGATGTTGCTTTGGGTTGTAGCTCGGGGGAAAATCTGTATCGGACCGCAGGTAGGATGCTGTCTGCTT
TGCTGA
page-top