Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2331
Contig Information
Length 698 bp
Tissue Seed DPA20
Clones 9 Clones [Download: CSV  ,  FASTA ]
whdp10f04    whdp19d04    rwhdp10f04    rwhdp9j06    rwhdp9l16    rwhdp14f03    rwhdp16c08    rwhdp16e05    rwhdp19d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L9 [Zea mays] >gi|195624144|gb|ACG33902.1| 60S ribosomal protein L9 [Zea mays]
Score 693
Evalue 3.31291e-71
Total Hit Count 430
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2331
TTTTACCTCAAATACTTCCGAGTCTTCAGCCTTTATAGGGGTAGATAAGCGTCGCTACCGATTCTCGCGGCGACAATATGCAGGATAATAAAGATAACAT
GTTCCATGGCACATCCCTAACAATTAACTCCACTACAAAATTCAGTCTAGAGAGAGTTCAAAATCACGACAACGACGACACAAAGACGATGAAACACGGC
AGGCAGAAACACGGCTTCTGGTGGGACGGTTTTTCGCACTCTACTCCTCCTTGATGGCGCCCTTGTCGCTGACGTAGATACCGTCCAAGAACTTCCTGAT
ATCCTTGTTCTTGACGTGGCATTTCTGGTTGATCAGGGCAGCAGAGCGAGAGACTAGCTCGATGTCGTTGCCATCCAGGACAATCTCATCCTTAACTTTC
TCGGACCGCAGGATCGTCACACCGTCAAGCATGTCTACTTTCCTTACCTTCTTCTCGCCGAGGAAGTTCCTGATCTCGATGCCCTTGTTGGCGGCGGTGA
TGGAGGCGTTGATGGGGAAGTGGGCGTACACGAAGCGCATCTTGTAGCGGAAGCCCTTGGTGACGCCGGTGATGAGGTTCTGGACGTGGGAGATGGCGGT
GCGGATGGCGGCCATGGTCTTGCGGGTGCCGAACCAGGCGTCCACCTTGAGCTTGCGCCCGCCCTCCTGCAGCTGGAAGTCGAGGTGAGGTGCTGAAG
page-top