Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2327
Contig Information
Length 692 bp
Tissue Seed DPA20
Clones 9 Clones [Download: CSV  ,  FASTA ]
whdp10c03    whdp3a06    whdp18i23    whdp19n09    rwhdp10c03    rwhdp3a06    rwhdp3o11    rwhdp18i23    rwhdp19n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195608846|gb|ACG26253.1| NADH-ubiquinone oxidoreductase 13 kDa-B subunit [Zea mays] >gi|195637862|gb|ACG38399.1| NADH-ubiquinone oxidoreductase 13 kDa-B subunit [Zea mays]
Score 686
Evalue 2.13607e-70
Total Hit Count 127
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2327
TGTGTTGAAGCACTGCGTTAAAAACGCATTCACATTCACAGAAACAAATTTATTCTGCTCGGGACAACAAGCAAACTGCAGGCAAAGGACCCATGAGACT
AGTCTCAACTACACACTGCAACAGGTGAAAAATGATGCATCTTGAAGAGTTCAAGTTTCATGACTTCACTTGCGGAGGAGAGTCGCCCTGCAGAGCTGGA
TCTGATTTGATGGCATCTAATGTCTTGAAGAACTCCTCAGGTAGTGCAACGGGCCGGTGCTGCGGAACATGCTTGGGAATAGGTGTGTCATCTTCAATCA
CCTCGCATTCGTAGTCATCAGGAACACCCCAGGGATCCCACTCGATCATCTTGCCGATGAGCTTAAGCTCGTCCTCGGCCTCCTCGATGAGCTCCTCGAC
CTGGCCGCAGCCGAGGCGGTCCTCGATGCGCTTCCAGTCCTCCTCCTCCTGGCAGATCTGGAGGCGGTAGCGGGTGAAGGACTCGACGGCCTTGCGGTAG
CCCTCGTCCTTGGGGACGGCCTCGATCTCCTTGAGGGTGCGCGTGTAGAGCCCGATGAGCACATTCCGCGCCTCGGGCACCACGTCCAGACCCACGATCC
CCGTCGTCTCCTTCACCGCCCGCGCAGAGCGCAGGGCCGCCAGCCCGCCCCCACCGCTCAGGATCCGCCGCAGAAACATCCCGCCGCCGTCT
page-top