Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2325
Contig Information
Length 584 bp
Tissue Seed DPA20
Clones 9 Clones [Download: CSV  ,  FASTA ]
whdp10b07    whdp3f11    whdp9h10    whdp18g05    whdp18g16    rwhdp10b07    rwhdp3f11    rwhdp9h10    rwhdp18g16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 198
Evalue 5.49578e-14
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2325
TTCGAGCGCCTCCTCCTGTCTCGTCCTCGTCCCCCGTCCCCCGTCCCCTCGTCGGCGCCCGATCTAAGTCAAGATGAGTCGTGGCGGGAGTGCTGGAGGT
GGTCAAAGTTCTCTGGGTTACCTGTTTGGAGATGGTGAGCCTGCAAAGCCTGCTGCAGCACCAGCTGCGAAGCCAGCACCTGCTGAGAAACCAGCACTGG
CAGCTGCCGATGTAACCAAGCAGATTCCAGCTGGCATTCCAGGTAGCCGGGCGAACAACTACTACCGTGCAGATGGCCAGAACACGGGCAACTTCCTTAC
GGACCGTCCTTCAACCAAGGTTCATGCTGCTCCCGGCGGTGGCTCGTCCCTGGGCTACTTGTTTGGCGGGAAGTGATCTCTGTTAATGATGCTGCGATGA
ATTGGCCTGTATCTCTGTTATCCATGTGGTGAAAACTGGAAGTGTTTGGTTTCAGCAGTTTACCACCTGCGTCGATGTACTCTGTCTGTATGGTTCATTG
TGTCCAGGCTGACCTCCTGCTTGGAAGCCAGCTTGCCTAAAACCTGTCGCTTTCAAACTAATCGTCTTCATCTCAAAAAAAAAA
page-top